Optimasi Perancangan Primer Secara Bioinformatik untuk Diagnosis Infeksi Gonore Menggunakan Metode Real-Time Polymerase Chain Reaction

Farida Budiyanti Putri, Dina Mulyanti, Sani Ega Priani

Abstract


ABSTRACT: Gonorrhea is a sexually transmitted infectious disease caused by the Gram-negative bacterium Neisseria gonorrhoeae. The method of diagnosis that is often used is culture media, which has a drawback, including sensitivity. The Real Time-PCR method is a solution for the diagnosis of gonorrhea infection. In Real Time-PCR, a primer in the form of a short-chain DNA sequence is needed as a specific target DNA identifier. The gene used for primary design is the opa gene. This study aims to design a method of diagnosing gonorrhea using Real Time-PCR through an opa gene primer design approach to diagnosing gonorrhea quickly and accurately. The primary design was carried out using the Primer Quest, Oligoanalayzer, MFEPrimer, and Snapgene Viewer sites. The nucleotide sequences of the opa gene can be searched on the NCBI site which was further analyzed using the Primer Quest, Oligoanalayzer, MFEPrimer, and Snapgene Viewer programs. Opa gene primer design results obtained 5 primer candidates with the best primer, Oligo 1 which has a forward primer base sequence of 5’ GCACGGTAAGCGATTATTTCAG 3’ (22 mer; Tm 54,2°C; %GC 45,5; ΔG hairpin -1,97, dan ΔG self dimer -3,61 kcal/mol) and reverse yaitu 5’ CCACTTTCTGTAACGGGCATA 3’ (22 mer; Tm 55,1°C; %GC 45,5; ΔG hairpin  1,05 kcal/mol dan ΔG self dimer -3,61 kcal/mol) and ΔG heterodimer -4,3.

Keyword: gonorrhea, opa gene, primary design, Neisseria gonorrhoeae.

ABSTRAK: Gonore merupakan suatu penyakit Infeksi Menular Seksual yang disebabkan oleh bakteri kokus Gram negatif Neisseria gonorrhoeae. Metode diagnosis yang sering digunakan adalah kultur media yang memiliki kekurangan antaranya adalah sensitivitas. Metode Real Time-PCR menjadi solusi untuk diagnosis infeksi gonore. Pada Real Time-PCR dibutuhkan sebuah primer berupa sekuens DNA rantai pendek sebagai pengenal DNA target secara spesifik. Gen yang digunakan untuk perancangan primer adalah opa gen. Penelitian ini bertujuan untuk merancang metode diagnosis gonore menggunakan Real Time-PCR melalui pendekatan perancangan primer gen opa untuk mendiagnosa penyakit gonore yang cepat dan akurat. Desain primer dilakukan menggunakan situs Primer Quest, Oligoanalayzer, MFEPrimer dan Snapgene Viewer. Sekuen nukleotida dari opa gen dapat dicari dalam situs NCBI yang dianalsis lebih lanjut menggunakan program Primer Quest, Oligoanalayzer, MFEPrimer dan Snapgene Viewer. Hasil perancangan primer opa gen diperoleh 5 kandidat primer dengan primer terbaik yakni Oligo 1 yang memiliki urutan basa primer forward yaitu 5’ GCACGGTAAGCGATTATTTCAG 3’ (22 mer; Tm 54,2°C; %GC 45,5; ΔG hairpin -1,97, dan ΔG self dimer -3,61 kcal/mol) dan reverse yaitu 5’ CCACTTTCTGTAACGGGCATA 3’ (22 mer; Tm 55,1°C; %GC 45,5; ΔG hairpin  1,05 kcal/mol dan ΔG self dimer -3,61 kcal/mol) serta heterodimer dengan nilai ΔG -4,3.

Kata Kunci: gonore, gen opa, desain primer, Neisseria gonorrhoeae.


Keywords


gonore, gen opa, desain primer, Neisseria gonorrhoeae.

Full Text:

PDF

References


Dennis Lo, Y. M., Chiu, R. W. K. and Chan, K. C. A. (2006) Clinical Application of PCR, Humana Press Inc. 999 Riverview Drive, Suite 208 Totowa, New Jersey 07512.

Ernawati (2010) ‘Gonorrhea Urethritis’, Jurnal ilmiah Kedokteran, Edisi Khusus, pp. 40–46.

Ferlianti, R., Supali, T. and Wibowo, H. (2012) ‘Optimalisasi Real Time PCR untuk Diagnosis Filariasis Bancrofti pada Sediaan Hapus Darah Tebal Optimization of Real Time PCR for the Diagnosis of Bancroftian Filariasis on Thick Blood Film Preparation’, Jurnal Kedokteran Yarsi, 20(1), pp. 014–022.

Geraats-Peters, C. W. M. et al. (2005) ‘Specific and sensitive detection of Neisseria gonorrhoeae in clinical specimens by real-time PCR’, Journal of Clinical Microbiology, 43(11), pp. 5653–5659. Hill, S. A., Masters, T. L. and Wachter, J. (2016) ‘Gonorrhea – An evolving disease of the new millennium’, Microbial Cell, 3(9), pp. 371–389.

Malorny, B. et al. (1998) ‘Sequence diversity, predicted two-dimensional protein structure, and epitope mapping of neisserial Opa proteins’, Journal of Bacteriology, 180(5), pp. 1323–1330.

Mawarnursavira, K., Sari, R. and Apridamayanti, P. (2016) ‘Optimasi Melting Temperature Primer Degenerate Pada Suhu 60°C Gen Erm(T) (Erythromycin Ribosome Methylase) Yang Resistensi Terhadap Bakteri Streptococcus pyogenes’.

Meyer, T. and Buder, S. (2020) ‘The laboratory diagnosis of neisseria gonorrhoeae: Current testing and future demands’, Pathogens, 9(2), pp. 1–19. Nurmala, N. and Idawati, I. (2018) ‘Pengetahuan dan Sikap Tentang Penyakit Infeksi Menular Seksual (IMS) pada Ibu Rumah Tangga di Puskesmas Tulang Bawang Barat’, Jurnal Ilmiah Keperawatan Sai Betik, 13(2), p. 186.

Pratiwi, A., Sari, R. and Apridamayanti, P. (2017) ‘Optimasi Suhu Desain Primer Gen Blaz Resistensi Pada Bakteri Staphylococcus Aureus Secara In Silico’, (1), pp. 3–12.

Rudiretna, A. and Handoyo, D. (2001) ‘Prinsip Umum Dan Pelaksanaan Polymerase Chain Reaction (PCR)’, 9(1), pp. 17–29.

Sunarno and Novriani, H. (2016) ‘Desain Primer PCR Secara Manual untuk Amplifikasi Gen dtx Bakteri Penyebab Difteri dengan Masalah Homologi Sekuens DNA’, The Biomedical and Basic Health Tecnology, Health Research and Development Centre, Jakarta, 66(12), p. 2.

Syaputra, D., Sari, R. and Apridamayanti, P. (2018) ‘Desain Primer Spesifik Gen Tetb (Tetracycline Resistance Protein) Bakteri Bacillus subtilis’, pp. 1–11.

Tooy, D. C., Bernadus, J. B. and Sorisi, A. (2016) ‘Deteksi Plasmodium falciparum dengan menggunakan metode real-time polymerase chain reaction di daerah Likupang dan Bitung’, Jurnal e-Biomedik, 4(1).

Unemo, M. et al. (2019) ‘Gonorrhoea’, Nature Reviews Disease Primers, 5(1).

Wijanarko, M. S. P. (2019) ‘Infeksi, Rekomendasi Terapi, dan Resistensi Gonore’, Cermin Dunia Kedokteran, 46(8), pp. 511–515.

Zilhadia, Z., Izzah, A. N. and Betha, O. S. (2017) ‘Perbandingan Metode SYBR Green dan Hydrolysis Probe dalam Analisis DNA Gelatin Sapi dan Gelatin Babi Menggunakan Real Time Polymerase Chain Reaction’, Jurnal Sains Farmasi & Klinis, 4(1), p. 16.




DOI: http://dx.doi.org/10.29313/.v0i0.28746

Flag Counter